Stem-loop sequence mmu-mir-25

Accession

MI0000689 (change log)

Symbol

MGI:Mir25

Description

Mus musculus miR-25 stem-loop

Gene family

MIPF0000013; mir-25

Literature search

91 open access papers mention mmu-mir-25
(495 sentences)

Stem-loop

       a ug   ag    g     uu g     u   --  ac 
5' ggcc g  uug  aggc gagac  g gcaau gcu  gg  g
   |||| |  |||  |||| |||||  | ||||| |||  ||  c
3' ccgg c  gac  ucug cucug  c cguua cgg  cc  u
       c gu   ag    g     uu a     -   gu  cg 

Deep sequencing

3783118 reads, 8.54e+03 reads per million, 107 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Mouse mir-25 is predicted [3] based on homology to a cloned miR from human (MI0000082) [1]. Its expression has been later independently verified in mouse [2,4].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr5: 138165321-138165404 [-]
• Overlapping transcripts:

  sense

  OTTMUST00000054336 ; Mcm7-010; exon 1

  OTTMUST00000054328 ; Mcm7-002; intron 8

  OTTMUST00000054327 ; Mcm7-001; intron 13

  ENSMUST00000125316 ; Mcm7-010; exon 1

  ENSMUST00000148879 ; Mcm7-002; intron 8

  ENSMUST00000000505 ; Mcm7-001; intron 13

Clustered miRNAs

< 10kb from mmu-mir-25

• mmu-mir-106b: chr5: 138165737-138165818 [-]
• mmu-mir-93: chr5: 138165523-138165610 [-]
• mmu-mir-25: chr5: 138165321-138165404 [-]

Database links

• EntrezGene:Mirn25
• MGI:Mir25
• RNAcentral:URS00000C85B2_10090
• miRBase Tracker:MI0000689

Mature sequence mmu-miR-25-5p

• Accession: MIMAT0017049
• Previous IDs: mmu-miR-25*
• Sequence: 14 - aggcggagacuugggcaauugc - 35
• Deep sequencing: 97358 reads, 90 experiments
• Evidence: experimental; 454 [6], Illumina [7]
• Database links:
  • RNAcentral:URS00001DD9A7_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-25-5p
  • miRDB:mmu-miR-25-5p

Mature sequence mmu-miR-25-3p

• Accession: MIMAT0000652
• Previous IDs: mmu-miR-25
• Sequence: 52 - cauugcacuugucucggucuga - 73
• Deep sequencing: 3685656 reads, 107 experiments
• Evidence: experimental; cloned [2,4], Illumina [5,7]
• Database links:
  • RNAcentral:URS00004F9744_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-25-3p
  • miRDB:mmu-miR-25-3p
  • microrna.org:mmu-miR-25-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).