![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-344-1 |
|||||
Accession | MI0000630 (change log) | ||||
Previous IDs | mmu-mir-344 | ||||
Symbol | MGI:Mir344 | ||||
Description | Mus musculus miR-344-1 stem-loop | ||||
Gene family | MIPF0000267; mir-344 | ||||
Literature search |
![]()
10 open access papers mention mmu-mir-344-1 | ||||
Stem-loop |
cugcagc uuac cc uc a 5' caggguuu cagucaggcu uggcuagau cagguacc g |||||||| |||||||||| ||||||||| |||||||| 3' gucccgaa gucaguccga accgaucua guccaugg c ---acaa ---u -a -- u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000629) - its expression was later independently verified in mouse [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-344-5p |
|
Accession | MIMAT0017038 |
Previous IDs | mmu-miR-344* |
Sequence |
21 - agucaggcuccuggcuagauuccagg - 46 |
Deep sequencing | 112 reads, 14 experiments |
Evidence | experimental; Illumina [3] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-344-3p |
|
Accession | MIMAT0000593 |
Previous IDs | mmu-miR-344 |
Sequence |
61 - ugaucuagccaaagccugacugu - 83 |
Deep sequencing | 41588 reads, 54 experiments |
Evidence | experimental; cloned [1], Illumina [2-3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|