Stem-loop sequence rno-mir-301a

Accession

MI0000593 (change log)

Previous IDs

rno-mir-301

Description

Rattus norvegicus miR-301a stem-loop

Gene family

MIPF0000034; mir-130

Literature search

12 open access papers mention rno-mir-301a
(236 sentences)

Stem-loop

   ccugc    ua     ga  ac    c    ---u          ----a       
5'      uggc  cugcu  cg  ugcu ugac    uuauugcacu     cuguac 
        ||||  |||||  ||  |||| ||||    ||||||||||     ||||| u
3'      aucg  gacga  gc  acga acug    gauaacguga     gacaug 
   ----c    --     gg  cu    a    uuau          cgauc       

Deep sequencing

280211 reads, 231 reads per million, 500 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This rat miRNA has an independently verified homologue in mouse (MI0000401). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr10: 74417746-74417845 [+]
• Overlapping transcripts:

  sense

  ENSRNOT00000036098 ; Ska2-201; intron 1

Database links

• EntrezGene:Mir301a
• miRBase Tracker:MI0000593

Mature sequence rno-miR-301a-5p

• Accession: MIMAT0017026
• Previous IDs: rno-miR-301a*
• Sequence: 24 - gcucugacuuuauugcacuac - 44
• Deep sequencing: 798 reads, 247 experiments
• Evidence: experimental; SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-301a-5p
  • miRDB:rno-miR-301a-5p

Mature sequence rno-miR-301a-3p

• Accession: MIMAT0000552
• Previous IDs: rno-miR-301;rno-miR-301a
• Sequence: 61 - cagugcaauaguauugucaaagc - 83
• Deep sequencing: 278787 reads, 500 experiments
• Evidence: experimental; cloned [1-3], SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-301a-3p
  • miRDB:rno-miR-301a-3p
  • microrna.org:rno-miR-301a-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).