Stem-loop sequence mmu-mir-106a

Accession

MI0000406 (change log)

Symbol

MGI:Mir106a

Description

Mus musculus miR-106a stem-loop

Gene family

MIPF0000001; mir-17

Literature search

99 open access papers mention mmu-mir-106a
(392 sentences)

Stem-loop

       -ca       aa  g     -gu       
5' augu   aagugcu  ca ugcag   agcuuu 
   ||||   |||||||  || |||||   ||||| u
3' uaca   uucacga  gu acguc   uugagu 
       uuc       cc  g     auc       

Deep sequencing

263456 reads, 1.77e+03 reads per million, 107 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Mouse and human miR-106a (MI0000406 and MI0000113) differ at two positions but the precursor sequences are clearly closely related. The sequences are also related to mir-17 (MI0000071 and MI0000687). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chrX: 52742503-52742567 [-]
• Overlapping transcripts:

  sense

  OTTMUST00000042258 ; Kis2-002; exon 2

  OTTMUST00000042259 ; Kis2-003; exon 2

  OTTMUST00000042260 ; Kis2-004; exon 2

  OTTMUST00000042121 ; Kis2-001; exon 3

  ENSMUST00000138156 ; Kis2-002; exon 2

  ENSMUST00000133214 ; Kis2-003; exon 2

  ENSMUST00000154488 ; Kis2-004; exon 2

  ENSMUST00000143479 ; Kis2-001; exon 3

Clustered miRNAs

< 10kb from mmu-mir-106a

• mmu-mir-106a: chrX: 52742503-52742567 [-]
• mmu-mir-18b: chrX: 52742331-52742413 [-]
• mmu-mir-20b: chrX: 52742113-52742192 [-]
• mmu-mir-19b-2: chrX: 52741983-52742066 [-]
• mmu-mir-92a-2: chrX: 52741838-52741928 [-]
• mmu-mir-363: chrX: 52741693-52741767 [-]

Database links

• EntrezGene:Mir106a
• MGI:Mir106a
• RNAcentral:URS000075D3AB_10090
• miRBase Tracker:MI0000406

Mature sequence mmu-miR-106a-5p

• Accession: MIMAT0000385
• Previous IDs: mmu-miR-106a
• Sequence: 5 - caaagugcuaacagugcagguag - 27
• Deep sequencing: 263213 reads, 107 experiments
• Evidence: experimental; cloned [1-2], Illumina [3-4]
• Database links:
  • RNAcentral:URS00001B64CE_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-106a-5p
  • miRDB:mmu-miR-106a-5p
  • microrna.org:mmu-miR-106a-5p

Mature sequence mmu-miR-106a-3p

• Accession: MIMAT0017009
• Previous IDs: mmu-miR-106a*
• Sequence: 41 - acugcagugccagcacuucuuac - 63
• Deep sequencing: 243 reads, 31 experiments
• Evidence: experimental; Illumina [4]
• Database links:
  • RNAcentral:URS000061890D_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-106a-3p
  • miRDB:mmu-miR-106a-3p

References

1. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).