![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-204 |
|||||
Accession | MI0000247 (change log) | ||||
Symbol | MGI:Mir204 | ||||
Description | Mus musculus miR-204 stem-loop | ||||
Gene family | MIPF0000042; mir-204 | ||||
Literature search |
![]()
84 open access papers mention mmu-mir-204 | ||||
Stem-loop |
u u a u gagaau 5' ggac ucccuuuguc uccua gccu a |||| |||||||||| ||||| |||| u 3' cuug agggaaacgg agggu cgga a a c a - ggaagu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-204-5p |
|
Accession | MIMAT0000237 |
Previous IDs | mmu-miR-204 |
Sequence |
6 - uucccuuugucauccuaugccu - 27 |
Deep sequencing | 33017 reads, 72 experiments |
Evidence | experimental; cloned [1-3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-204-3p |
|
Accession | MIMAT0017002 |
Previous IDs | mmu-miR-204* |
Sequence |
45 - gcugggaaggcaaagggacgu - 65 |
Deep sequencing | 1513 reads, 42 experiments |
Evidence | experimental; Illumina [5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|