Stem-loop sequence hsa-mir-3132

Accession

MI0014152 (change log)

Symbol

HGNC:MIR3132

Description

Homo sapiens miR-3132 stem-loop

Gene family

MIPF0001509; mir-3132

Stem-loop

              u    -a   a      a   ----c  u 
5' ggugggauggg agag  agg gcucag gga     gg g
   ||||||||||| ||||  ||| |||||| |||     ||  
3' ccacccuacuc ucuc  ucc cgaguu ccu     cc c
              -    cc   -      c   uuguu  g 

Deep sequencing

147 reads, 0 reads per million, 59 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr2: 219549073-219549147 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000336658 ; STK36-012; intron 1

  OTTHUMT00000336656 ; STK36-010; intron 2

  OTTHUMT00000256723 ; STK36-001; intron 10

  OTTHUMT00000256724 ; STK36-002; intron 10

  OTTHUMT00000336649 ; STK36-003; intron 10

  ENST00000422778 ; STK36-012; intron 1

  ENST00000414413 ; STK36-010; intron 2

  ENST00000295709 ; STK36-001; intron 10

  ENST00000392105 ; STK36-002; intron 10

  ENST00000440309 ; STK36-003; intron 10

  ENST00000392106 ; STK36-201; intron 10

Database links

• EntrezGene:MIR3132
• HGNC:MIR3132
• miRBase Tracker:MI0014152

Mature sequence hsa-miR-3132

• Accession: MIMAT0014997
• Sequence: 8 - uggguagagaaggagcucagagga - 31
• Deep sequencing: 89 reads, 31 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-3132
  • TargetScanVert:hsa-miR-3132
  • miRDB:hsa-miR-3132
  • microrna.org:hsa-miR-3132

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).