![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-548s |
|||||
Accession | MI0014141 (change log) | ||||
Symbol | HGNC:MIR548S | ||||
Description | Homo sapiens miR-548s stem-loop | ||||
Gene family | MIPF0000317; mir-548 | ||||
Literature search |
![]()
42 open access papers mention hsa-mir-548s | ||||
Stem-loop |
u c u uuuaa 5' ug ugcaaaaauaauugcaguuuu gccauuauu u || ||||||||||||||||||||| ||||||||| 3' ac acguuuuuauugacgucaaaa cgguaauaa a a c c uauua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-548s |
|
Accession | MIMAT0014987 |
Sequence |
52 - auggccaaaacugcaguuauuuu - 74 |
Deep sequencing | 2727 reads, 121 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|