Stem-loop sequence hsa-mir-548s

AccessionMI0014141 (change log)
Symbol HGNC:MIR548S
DescriptionHomo sapiens miR-548s stem-loop
Gene family MIPF0000317; mir-548
Literature search

42 open access papers mention hsa-mir-548s
(142 sentences)

Stem-loop
   u  c                     u         uuuaa 
5'  ug ugcaaaaauaauugcaguuuu gccauuauu     u
    || ||||||||||||||||||||| |||||||||      
3'  ac acguuuuuauugacgucaaaa cgguaauaa     a
   a  c                     c         uauua 
Get sequence
Deep sequencing
3548 reads, 5.56 reads per million, 126 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 11767444-11767525 [+]
sense
OTTHUMT00000280495 ; GREB1-006; intron 8
OTTHUMT00000280490 ; GREB1-001; intron 25
ENST00000396123 ; GREB1-006; intron 8
ENST00000234142 ; GREB1-201; intron 24
ENST00000381486 ; GREB1-001; intron 25
Database links

Mature sequence hsa-miR-548s

Accession MIMAT0014987
Sequence

52 - 

auggccaaaacugcaguuauuuu

 - 74

Get sequence
Deep sequencing2727 reads, 121 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).