Stem-loop sequence mmu-mir-3113

AccessionMI0014111 (change log)
Symbol MGI:Mir3113
DescriptionMus musculus miR-3113 stem-loop
Literature search

1 open access papers mention mmu-mir-3113
(6 sentences)

Stem-loop
   ------    cu  c     u  -u    cu  u  -    c 
5'       ggcc  gg ccggg cc  ggcc  gg cc gggu c
         ||||  || ||||| ||  ||||  || || ||||  
3'       ccgg  cc ggucc gg  ccgg  cc gg cccg u
   ccgguc    -u  u     u  uc    -u  u  u    g 
Get sequence
Deep sequencing
66 reads, 0 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 151859562-151859637 [+]
sense
OTTMUST00000046396 ; Huwe1-001; intron 14
OTTMUST00000046226 ; Huwe1-002; intron 16
OTTMUST00000046227 ; Huwe1-003; intron 17
OTTMUST00000046228 ; Huwe1-004; exon 17
OTTMUST00000046230 ; Huwe1-006; exon 18
OTTMUST00000046229 ; Huwe1-005; exon 18
ENSMUST00000112622 ; Huwe1-001; intron 14
ENSMUST00000026292 ; Huwe1-002; intron 16
ENSMUST00000153687 ; Huwe1-003; intron 17
ENSMUST00000130243 ; Huwe1-004; exon 17
ENSMUST00000131786 ; Huwe1-006; exon 18
ENSMUST00000150020 ; Huwe1-005; exon 18
Database links

Mature sequence mmu-miR-3113-5p

Accession MIMAT0014959
Previous IDsmmu-miR-3113
Sequence

14 - 

guccuggcccugguccgggucc

 - 35

Get sequence
Deep sequencing45 reads, 19 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3113-3p

Accession MIMAT0014960
Previous IDsmmu-miR-3113*
Sequence

45 - 

uccuggcccugguccugguc

 - 64

Get sequence
Deep sequencing17 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).