Stem-loop sequence mmu-mir-3110

AccessionMI0014107 (change log)
Symbol MGI:Mir3110
DescriptionMus musculus miR-3110 stem-loop
Stem-loop 
   u      c  u  -         cc  a  -    u uug 
5'  gugggg ug gu ucugccucc  ug ag gcuc g   u
    |||||| || || |||||||||  || || |||| |    
3'  cacccc ac ca agacggagg  ac uc cggg c   c
   a      a  u  c         cu  c  a    u uca
Get sequence
Deep sequencing
210 reads, 0 reads per million, 56 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 38210441-38210520 [+]
antisense
OTTMUST00000041720 ; Fam70a-003; intron 6
OTTMUST00000041719 ; Fam70a-002; intron 7
OTTMUST00000041811 ; Fam70a-004; intron 8
OTTMUST00000041810 ; Fam70a-001; intron 8
ENSMUST00000155848 ; Tmem255a-003; intron 6
ENSMUST00000089054 ; Tmem255a-002; intron 7
ENSMUST00000089056 ; Tmem255a-004; intron 8
ENSMUST00000066498 ; Tmem255a-001; intron 8
Database links

Mature sequence mmu-miR-3110-5p

Accession MIMAT0014951
Previous IDsmmu-miR-3110
Sequence

13 -  

uucugccuccccugaaggcuc

 - 33

Get sequence
Deep sequencing200 reads, 55 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3110-3p

Accession MIMAT0014952
Previous IDsmmu-miR-3110*
Sequence

48 -  

gcacuccaucggaggcagacac

 - 69

Get sequence
Deep sequencing8 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).