Stem-loop sequence mmu-mir-3060

AccessionMI0014022 (change log)
Symbol MGI:Mir3060
DescriptionMus musculus miR-3060 stem-loop
Literature search

1 open access papers mention mmu-mir-3060
(1 sentences)

Stem-loop
        u  -g      g        -     uc     gaag 
5' gggcg gg  gguggg agugcuuc gugcu  ugguu    a
   ||||| ||  |||||| |||||||| |||||  |||||    g
3' ucugu uc  ccaccc ucacgaag cacga  accag    a
        u  ga      -        a     -u     uaaa 
Get sequence
Deep sequencing
1838 reads, 401 reads per million, 101 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 4139364-4139446 [+]
sense
OTTMUST00000011254 ; Rnf215-001; intron 5
ENSMUST00000003677 ; Rnf215-001; intron 5
Database links

Mature sequence mmu-miR-3060-5p

Accession MIMAT0014826
Previous IDsmmu-miR-3060*
Sequence

14 - 

gggagugcuucgugcuucug

 - 33

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-3060-3p

Accession MIMAT0014827
Previous IDsmmu-miR-3060
Sequence

50 - 

ccauagcacagaagcacuccca

 - 71

Get sequence
Deep sequencing1569 reads, 86 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).