Stem-loop sequence mmu-mir-2139

AccessionMI0010752 (change log)
Symbol MGI:Mir2139
DescriptionMus musculus miR-2139 stem-loop
Stem-loop
   ag   ga    agg       cu   auuuggacau        --c     ag 
5'   aag  gcag   gccagga  ggc          gcagcugc   cagca  g
     |||  ||||   |||||||  |||          ||||||||   |||||   
3'   uuc  cguc   ugguccu  ucg          cgucgacg   gucgu  u
   --   gg    -aa       cg   ----------        ccu     gg 
Get sequence
Deep sequencing
25 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 139967526-139967620 [-]
sense
OTTMUST00000023384 ; Klhdc7a-001; exon 1
ENSMUST00000105031 ; Klhdc7a-001; exon 1
Database links

Mature sequence mmu-miR-2139

Accession MIMAT0011215
Sequence

67 - 

agcugcgcugcuccugguaacugc

 - 90

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:19351399 "Identification and characterization of new miRNAs cloned from normal mouse mammary gland" Sdassi N, Silveri L, Laubier J, Tilly G, Costa J, Layani S, Vilotte JL, Le Provost F BMC Genomics. 10:149(2009).