Stem-loop sequence mmu-mir-1938

AccessionMI0009927 (change log)
Symbol MGI:Mir1938
DescriptionMus musculus miR-1938 stem-loop
Literature search

1 open access papers mention mmu-mir-1938
(1 sentences)

Stem-loop 
   -- ug     c       c             ------uu    --u     gc 
5'   c  gggcg gguggga uuguaguucgguc        cgcu   cggac  c
     |  ||||| ||||||| |||||||||||||        ||||   |||||   
3'   g  cccgu cuacccu gacgucaagucgg        gcga   gucug  c
   ag gu     a       u             cauggugc    uac     aa
Get sequence
Deep sequencing
387 reads, 0 reads per million, 53 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 40222712-40222811 [-]
sense
OTTMUST00000090788 ; Ifrd1-001; intron 1
OTTMUST00000090794 ; Ifrd1-007; intron 1
OTTMUST00000090789 ; Ifrd1-002; intron 1
OTTMUST00000090799 ; Ifrd1-008; intron 1
OTTMUST00000090795 ; Ifrd1-005; intron 2
OTTMUST00000090797 ; Ifrd1-004; intron 2
OTTMUST00000090798 ; Ifrd1-003; intron 2
ENSMUST00000001672 ; Ifrd1-001; intron 1
ENSMUST00000171530 ; Ifrd1-007; intron 1
ENSMUST00000170752 ; Ifrd1-002; intron 1
ENSMUST00000171553 ; Ifrd1-008; intron 1
ENSMUST00000169926 ; Ifrd1-005; intron 2
ENSMUST00000169319 ; Ifrd1-004; intron 2
ENSMUST00000164354 ; Ifrd1-003; intron 2
antisense
OTTMUST00000090790 ; RP23-111F7.1-001; 3'UTR (exon 1)
ENSMUST00000038121 ; Gm7008-001; 3'UTR (exon 1)
Database links

Mature sequence mmu-miR-1938

Accession MIMAT0009402
Sequence

9 -  

cggugggacuuguaguucgguc

 - 30

Get sequence
Deep sequencing322 reads, 44 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).