![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-1929 |
|||||
Accession | MI0009918 (change log) | ||||
Symbol | MGI:Mir1929 | ||||
Description | Mus musculus miR-1929 stem-loop | ||||
Stem-loop |
g g u a a a gu ug a 5' uuagaacu g agguc ucuagg cuuuau gagc gag u c g |||||||| | ||||| |||||| |||||| |||| ||| | | c 3' agucuugg u uccgg ggaucc gaggua cucg cuc a g c g - u a - a ac gu u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-1929-5p |
|
Accession | MIMAT0009392 |
Previous IDs | mmu-miR-1929 |
Sequence |
17 - uucuaggacuuuauagagcagag - 39 |
Deep sequencing | 1309 reads, 65 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-1929-3p |
|
Accession | MIMAT0022729 |
Sequence |
59 - cagcucauggagaccuaggugg - 80 |
Deep sequencing | 14 reads, 13 experiments |
Evidence | not experimental |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:18849523
"In-depth characterization of the microRNA transcriptome in a leukemia progression model"
Genome Res. 18:1787-1797(2008).
|