Stem-loop sequence hsa-mir-1537

AccessionMI0007258 (change log)
Symbol HGNC:MIR1537
DescriptionHomo sapiens miR-1537 stem-loop
Gene family MIPF0000917; mir-1537
Literature search

1 open access papers mention hsa-mir-1537
(1 sentences)

Stem-loop 
                 u a         ccu 
5' acagcuguaauuag c guuuucugu   g
   |||||||||||||| | |||||||||   u
3' uguugacauugauc g caaaagaca   c
                 u c         cac
Get sequence
Deep sequencing
626 reads, 2.78 reads per million, 72 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 235853000-235853060 [-]
sense
OTTHUMT00000097894 ; LYST-008; intron 16
OTTHUMT00000097533 ; LYST-001; intron 47
ENST00000473037 ; LYST-008; intron 16
ENST00000389794 ; LYST-001; intron 47
ENST00000389793 ; LYST-201; intron 47
Database links

Mature sequence hsa-miR-1537-5p

Accession MIMAT0026765
Sequence

3 -  

agcuguaauuagucaguuuucu

 - 24

Get sequence
Deep sequencing53 reads, 31 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence hsa-miR-1537-3p

Accession MIMAT0007399
Sequence

40 -  

aaaaccgucuaguuacaguugu

 - 61

Get sequence
Deep sequencing569 reads, 60 experiments
Evidence experimental; ChIP-seq [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:18524951 "Characterization of endogenous human Argonautes and their miRNA partners in RNA silencing" Azuma-Mukai A, Oguri H, Mituyama T, Qian ZR, Asai K, Siomi H, Siomi MC Proc Natl Acad Sci U S A. 105:7964-7969(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).