![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-484 |
|||||||
Accession | MI0006151 (change log) | ||||||
Description | Rattus norvegicus miR-484 stem-loop | ||||||
Gene family | MIPF0000219; mir-484 | ||||||
Literature search |
![]()
6 open access papers mention rno-mir-484 | ||||||
Stem-loop |
------gcaugca a ggcggggccucgcggccc 5' ggga ggggg u |||| ||||| 3' cccu ccccu g aaacuccaaauag - gacucggacugcuccguc |
||||||
Deep sequencing |
| ||||||
Confidence |
Annotation confidence: not enough data
| ||||||
Genome context |
|
||||||
Database links |
Mature sequence rno-miR-484 |
|
Accession | MIMAT0005319 |
Sequence |
46 - ucaggcucaguccccucccgau - 67 |
Deep sequencing | 18887 reads, 488 experiments |
Evidence | experimental; cloned [1], SOLiD [2] |
Predicted targets |
|
References |
|
1 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|