![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-376c |
||||||||||||||||||||||||||||||||||||||
Accession | MI0003533 (change log) | |||||||||||||||||||||||||||||||||||||
Symbol | MGI:Mir376c | |||||||||||||||||||||||||||||||||||||
Description | Mus musculus miR-376c stem-loop | |||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000091; mir-368 | |||||||||||||||||||||||||||||||||||||
Literature search |
![]()
24 open access papers mention mmu-mir-376c | |||||||||||||||||||||||||||||||||||||
Stem-loop |
u gu u g ua u --u u 5' uug auu aaaa gugga uuccu cuauguuua gc u ||| ||| |||| ||||| ||||| ||||||||| || u 3' aac uga uuuu cacuu aagga gauacaaau ug u a ug c g ua - uag u |
|||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||||||
Comments |
The mature miR-376c products have been shown to be modified by A to I edits [2]. |
|||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-376c-5p |
|
Accession | MIMAT0005295 |
Previous IDs | mmu-miR-376c* |
Sequence |
16 - guggauauuccuucuauguuua - 37 |
Deep sequencing | 22680 reads, 66 experiments |
Evidence | experimental; cloned [1], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-376c-3p |
|
Accession | MIMAT0003183 |
Previous IDs | mmu-miR-376c |
Sequence |
53 - aacauagaggaaauuucacgu - 73 |
Deep sequencing | 11418 reads, 71 experiments |
Evidence | experimental; cloned [1], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:17322061
"Redirection of silencing targets by adenosine-to-inosine editing of miRNAs"
Science. 315:1137-1140(2007).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|