![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-511 |
|||||
Accession | MI0005554 (change log) | ||||
Symbol | MGI:Mir511 | ||||
Description | Mus musculus miR-511 stem-loop | ||||
Gene family | MIPF0000130; mir-506 | ||||
Literature search |
![]()
10 open access papers mention mmu-mir-511 | ||||
Stem-loop |
-- a - a c cu c g a 5' gau ccca cc ug cuuuugcu gca uca uaaau a ||| |||| || || |||||||| ||| ||| ||||| 3' cua gggu gg ac gaaaacga ugu agu guuua u ac g a - a ug a - a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was independently shown in human and rat [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-511-5p |
|
Accession | MIMAT0004940 |
Previous IDs | mmu-miR-511 |
Sequence |
11 - augccuuuugcucugcacuca - 31 |
Deep sequencing | 271 reads, 50 experiments |
Evidence | experimental; RAKE [1], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-511-3p |
|
Accession | MIMAT0017281 |
Sequence |
49 - aauguguagcaaaagacaggau - 70 |
Deep sequencing | 7171 reads, 83 experiments |
Evidence | experimental; Illumina [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|