![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-673 |
||||||||
Accession | MI0004601 (change log) | |||||||
Symbol | MGI:Mir673 | |||||||
Description | Mus musculus miR-673 stem-loop | |||||||
Gene family | MIPF0000405; mir-673 | |||||||
Literature search |
![]()
9 open access papers mention mmu-mir-673 | |||||||
Stem-loop |
u cc --cu -- u u uc ga 5' ggag ugagggg cacag cuc gguccu ggagc ca g |||| ||||||| ||||| ||| |||||| ||||| || a 3' ccuc guucccc guguc gag ucgggg ccucg gu a a cc ccac uu - - uu aa |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence mmu-miR-673-5p |
|
Accession | MIMAT0003739 |
Previous IDs | mmu-miR-673 |
Sequence |
15 - cucacagcucugguccuuggag - 36 |
Deep sequencing | 32783 reads, 75 experiments |
Evidence | experimental; MPSS [1], cloned [2,4], miRAP-cloned [3], Illumina [5-6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-673-3p |
|
Accession | MIMAT0004824 |
Sequence |
55 - uccggggcugaguucugugcacc - 77 |
Deep sequencing | 4793 reads, 46 experiments |
Evidence | experimental; cloned [4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
2 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
3 |
PMID:16973894
"Mouse microRNA profiles determined with a new and sensitive cloning method"
Nucleic Acids Res. 34:e115(2006).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|