Stem-loop sequence mmu-mir-671

Accession

MI0004133 (change log)

Symbol

MGI:Mir671

Description

Mus musculus miR-671 stem-loop

Gene family

MIPF0000358; mir-671

Literature search

20 open access papers mention mmu-mir-671
(64 sentences)

Stem-loop

   u   ----a   ca        a   a      ga           -u   g 
5'  ggc     ggc  ggaagagg gga gcccug  ggggcuggagg  gau g
    |||     |||  |||||||| ||| ||||||  |||||||||||  |||  
3'  ccg     ccg  cuuucucc ccu cgggac  ucuuggccucc  uug a
   a   agaug   ag        a   -      --           uu   u 

Deep sequencing

27012 reads, 56.1 reads per million, 107 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr5: 24592114-24592211 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000075599 ; Chpf2-001; 3'UTR (exon 4)

  ENSMUST00000121863 ; Chpf2-001; 3'UTR (exon 4)

  ENSMUST00000088295 ; Chpf2-201; 3'UTR (exon 4)

  antisense

  OTTMUST00000075592 ; Smarcd3-002; exon 12

  ENSMUST00000144995 ; Smarcd3-002; exon 12

Database links

• EntrezGene:Mir671
• MGI:Mir671
• RNAcentral:URS000075E683_10090
• miRBase Tracker:MI0004133

Mature sequence mmu-miR-671-5p

• Accession: MIMAT0003731
• Previous IDs: mmu-miR-671
• Sequence: 19 - aggaagcccuggaggggcuggag - 41
• Deep sequencing: 19840 reads, 102 experiments
• Evidence: experimental; MPSS [1], RAKE [2], cloned [3], Illumina [4]
• Database links:
  • RNAcentral:URS00002FB368_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-671-5p
  • miRDB:mmu-miR-671-5p
  • microrna.org:mmu-miR-671-5p

Mature sequence mmu-miR-671-3p

• Accession: MIMAT0004821
• Sequence: 58 - uccgguucucagggcuccacc - 78
• Deep sequencing: 7128 reads, 99 experiments
• Evidence: experimental; cloned [3], Illumina [4-5]
• Database links:
  • RNAcentral:URS00002B7450_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-671-3p
  • miRDB:mmu-miR-671-3p
  • microrna.org:mmu-miR-671-3p

References

1. PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2. PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).