![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-503 |
||||||||||||||||
Accession | MI0003538 (change log) | |||||||||||||||
Symbol | MGI:Mir503 | |||||||||||||||
Description | Mus musculus miR-503 stem-loop | |||||||||||||||
Gene family | MIPF0000183; mir-503 | |||||||||||||||
Literature search |
![]()
49 open access papers mention mmu-mir-503 | |||||||||||||||
Stem-loop |
ua c g u a gu 5' ugccc gcag gggaacaguacu cag g gu u ||||| |||| |||||||||||| ||| | || u 3' auggg cguc ccuuuguuauga guc c cg g uc a g - - ug |
|||||||||||||||
Deep sequencing |
| |||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. |
|||||||||||||||
Genome context |
|
|||||||||||||||
Clustered miRNAs |
|
|||||||||||||||
Database links |
|
Mature sequence mmu-miR-503-5p |
|
Accession | MIMAT0003188 |
Previous IDs | mmu-miR-503 |
Sequence |
6 - uagcagcgggaacaguacugcag - 28 |
Deep sequencing | 190444 reads, 103 experiments |
Evidence | experimental; cloned [1,4-5], MPSS [2], miRAP-cloned [3], Illumina [6-7] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-503-3p |
|
Accession | MIMAT0004790 |
Previous IDs | mmu-miR-503* |
Sequence |
47 - gaguauuguuuccacugccugg - 68 |
Deep sequencing | 14341 reads, 99 experiments |
Evidence | experimental; cloned [5], Illumina [6-7] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
3 |
PMID:16973894
"Mouse microRNA profiles determined with a new and sensitive cloning method"
Nucleic Acids Res. 34:e115(2006).
|
4 | |
5 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
6 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
7 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|