Stem-loop sequence rno-mir-204

AccessionMI0000946 (change log)
DescriptionRattus norvegicus miR-204 stem-loop
Gene family MIPF0000042; mir-204
Literature search

38 open access papers mention rno-mir-204
(264 sentences)

Stem-loop 
   ggcuacagcccuucu   -  -    ucg     u          a     u    gagaau 
5'                uca ug ugac   uggac ucccuuuguc uccua gccu      a
                  ||| || ||||   ||||| |||||||||| ||||| ||||      u
3'                ggu ac acug   acuug agggaaacgg agggu cgga      a
   --------------c   c  u    uua     c          a     -    ggaagu
Get sequence
Deep sequencing
1592032 reads, 1.29e+03 reads per million, 492 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 240403000-240403109 [+]
sense
ENSRNOT00000018521 ; Trpm3-201; intron 5
Database links

Mature sequence rno-miR-204-5p

Accession MIMAT0000877
Previous IDsrno-miR-204
Sequence

33 -  

uucccuuugucauccuaugccu

 - 54

Get sequence
Deep sequencing1591114 reads, 492 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-204-3p

Accession MIMAT0004739
Previous IDsrno-miR-204*
Sequence

72 -  

gcugggaaggcaaagggacguu

 - 93

Get sequence
Deep sequencing879 reads, 134 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).