Stem-loop sequence rno-mir-193a

Accession

MI0000936 (change log)

Previous IDs

rno-mir-193

Description

Rattus norvegicus miR-193 stem-loop

Gene family

MIPF0000082; mir-193

Literature search

19 open access papers mention rno-mir-193a
(121 sentences)

Stem-loop

   gcggac          ag     u     cg   a  a    ggu 
5'       gggagcugag  cuggg cuuug  ggc ag ugag   g
         ||||||||||  ||||| |||||  ||| || ||||    
3'       cccucggcuc  gaccc gaaac  ccg uc acuu   u
   ------          cu     u     au   g  a    gac 

Deep sequencing

52295 reads, 46.2 reads per million, 476 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr10: 67065896-67065981 [+]
• Overlapping transcripts:

  antisense

  ENSRNOT00000053781 ; Mir3549-201; exon 1

Clustered miRNAs

< 10kb from rno-mir-193a

• rno-mir-3549: chr10: 67065885-67065996 [-]
• rno-mir-193a: chr10: 67065896-67065981 [+]

Database links

• EntrezGene:Mir193
• miRBase Tracker:MI0000936

Mature sequence rno-miR-193a-5p

• Accession: MIMAT0004736
• Previous IDs: rno-miR-193-5p
• Sequence: 20 - ugggucuuugcgggcaagauga - 41
• Deep sequencing: 891 reads, 262 experiments
• Evidence: experimental; cloned [2], SOLiD [3]
• Predicted targets:
  • TargetScanVert:rno-miR-193a-5p
  • miRDB:rno-miR-193a-5p
  • microrna.org:rno-miR-193a-5p

Mature sequence rno-miR-193a-3p

• Accession: MIMAT0000868
• Previous IDs: rno-miR-193-3p
• Sequence: 54 - aacuggccuacaaagucccagu - 75
• Deep sequencing: 51379 reads, 474 experiments
• Evidence: experimental; cloned [1-2], SOLiD [3]
• Predicted targets:
  • TargetScanVert:rno-miR-193a-3p
  • miRDB:rno-miR-193a-3p
  • microrna.org:rno-miR-193a-3p

References

1. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).