Stem-loop sequence rno-mir-125b-1

Accession

MI0000896 (change log)

Description

Rattus norvegicus miR-125b-1 stem-loop

Gene family

MIPF0000033; mir-10

Literature search

72 open access papers mention rno-mir-125b-1
(573 sentences)

Stem-loop

   u    uc c u   uc  ug   c           au     c 
5'  gcgc  c c cag  cc  aga ccuaacuugug  guuua c
    ||||  | | |||  ||  ||| |||||||||||  ||||| g
3'  cgug  g g guc  gg  ucu ggauugggcac  uaaau u
   -    cu a c   ga  gu   c           -c     u 

Deep sequencing

3165110 reads, 2.24e+03 reads per million, 495 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr8: 45798260-45798346 [+]
• Overlapping transcripts:

  sense

  ENSRNOT00000059997 ; intron 4

Database links

• EntrezGene:Mir125b-1
• miRBase Tracker:MI0000896

Mature sequence rno-miR-125b-5p

• Accession: MIMAT0000830
• Previous IDs: rno-miR-125b
• Sequence: 15 - ucccugagacccuaacuuguga - 36
• Deep sequencing: 6190734 reads, 493 experiments
• Evidence: experimental; cloned [1-5], Northern [1,3], SOLiD [6]
• Predicted targets:
  • TargetScanVert:rno-miR-125b-5p
  • miRDB:rno-miR-125b-5p
  • microrna.org:rno-miR-125b-5p

Mature sequence rno-miR-125b-1-3p

• Accession: MIMAT0004730
• Previous IDs: rno-miR-125b-3p
• Sequence: 55 - acggguuaggcucuugggagcu - 76
• Deep sequencing: 69763 reads, 467 experiments
• Evidence: experimental; cloned [4], SOLiD [6]
• Predicted targets:
  • TargetScanVert:rno-miR-125b-1-3p
  • miRDB:rno-miR-125b-1-3p
  • microrna.org:rno-miR-125b-1-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
6. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).