![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-30d |
|||||
Accession | MI0000869 (change log) | ||||
Description | Rattus norvegicus miR-30d stem-loop | ||||
Gene family | MIPF0000005; mir-30 | ||||
Literature search |
![]()
60 open access papers mention rno-mir-30d | ||||
Stem-loop |
a u u u ccc guaa c 5' aguc gug c guaaacauc gacuggaagcu gc a |||| ||| | ||||||||| ||||||||||| || 3' ucgg cau g cguuuguag cugacuuucga cg c c u c u --a --ac a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-30d-5p |
|
Accession | MIMAT0000807 |
Previous IDs | rno-miR-30d |
Sequence |
12 - uguaaacauccccgacuggaag - 33 |
Deep sequencing | 43529724 reads, 516 experiments |
Evidence | experimental; cloned [1-3], SOLiD [4] |
Predicted targets |
|
Mature sequence rno-miR-30d-3p |
|
Accession | MIMAT0004722 |
Previous IDs | rno-miR-30d* |
Sequence |
52 - cuuucagucagauguuugcugc - 73 |
Deep sequencing | 376216 reads, 507 experiments |
Evidence | experimental; cloned [3], SOLiD [4] |
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|