![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-30c-1 |
||||||
Accession | MI0000866 (change log) | |||||
Description | Rattus norvegicus miR-30c-1 stem-loop | |||||
Gene family | MIPF0000005; mir-30 | |||||
Literature search |
![]()
60 open access papers mention rno-mir-30c-1 | |||||
Stem-loop |
a uu ugu u u aca ---g a 5' ccaug guag g guaaaca ccu cucucagcu ug g ||||| |||| | ||||||| ||| ||||||||| || 3' gguac cguc c cauuugu ggg gagggucgg ac c a -- uuc u u --a ugga u |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence rno-miR-30c-5p |
|
Accession | MIMAT0000804 |
Previous IDs | rno-miR-30c |
Sequence |
17 - uguaaacauccuacacucucagc - 39 |
Deep sequencing | 11978233 reads, 511 experiments |
Evidence | experimental; cloned [1-5], SOLiD [6] |
Predicted targets |
|
Mature sequence rno-miR-30c-1-3p |
|
Accession | MIMAT0004719 |
Previous IDs | rno-miR-30c-1* |
Sequence |
56 - cugggagaggguuguuuacucc - 77 |
Deep sequencing | 23270 reads, 487 experiments |
Evidence | experimental; cloned [4], SOLiD [6] |
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:15345052
"Microarray analysis of microRNA expression in the developing mammalian brain"
Genome Biol. 5:R68(2004).
|
3 | |
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:17805466
"Cloning and identification of novel microRNAs from rat hippocampus"
Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
|
6 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|