![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-10a |
|||||
Accession | MI0000841 (change log) | ||||
Description | Rattus norvegicus miR-10a stem-loop | ||||
Gene family | MIPF0000033; mir-10 | ||||
Literature search |
![]()
31 open access papers mention rno-mir-10a | ||||
Stem-loop |
-----gacc --c uu a g c uaaggaa 5' ugu uguc cuguauau cccu uagau cgaauuugug u ||| |||| |||||||| |||| ||||| |||||||||| 3' aca acag gauguaua gggg aucua gcuuaaacac u acucgccuc aau uu a - u ugguguu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-10a-5p |
|
Accession | MIMAT0000782 |
Previous IDs | rno-miR-10a |
Sequence |
22 - uacccuguagauccgaauuugug - 44 |
Deep sequencing | 152447622 reads, 510 experiments |
Evidence | experimental; cloned [1-2], SOLiD [3] |
Predicted targets |
|
Mature sequence rno-miR-10a-3p |
|
Accession | MIMAT0004709 |
Sequence |
63 - caaauucguaucuaggggaaua - 84 |
Deep sequencing | 26185 reads, 405 experiments |
Evidence | experimental; cloned [2], SOLiD [3] |
Predicted targets |
|
References |
|
1 | |
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|