![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-296 |
||||||
Accession | MI0000747 (change log) | |||||
Symbol | HGNC:MIR296 | |||||
Description | Homo sapiens miR-296 stem-loop | |||||
Gene family | MIPF0000159; mir-296 | |||||
Literature search |
![]()
83 open access papers mention hsa-mir-296 | |||||
Stem-loop |
ga ca c c g ugc 5' ag cccuuc gagggcc cc cucaauccu uug c || |||||| ||||||| || ||||||||| ||| u 3' uc gggaag cucucgg gg ggguuggga gac a uc uc a u - uua |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
This sequence is the predicted human homologue of mouse miR-296 cloned from mouse embryonic stem cells [1,3]. Its expression has also been verified in human ES cells [2]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-296-5p |
|
Accession | MIMAT0000690 |
Previous IDs | hsa-miR-296 |
Sequence |
14 - agggcccccccucaauccugu - 34 |
Deep sequencing | 4652 reads, 150 experiments |
Evidence | experimental; cloned [2,4-5] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-296-3p |
|
Accession | MIMAT0004679 |
Sequence |
48 - gaggguuggguggaggcucucc - 69 |
Deep sequencing | 4308 reads, 118 experiments |
Evidence | experimental; cloned [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
2 |
PMID:15183728
"Human embryonic stem cells express a unique set of microRNAs"
Dev Biol. 270:488-498(2004).
|
3 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|