Stem-loop sequence hsa-mir-219a-2

Accession

MI0000740 (change log)

Symbol

HGNC:MIR219A2

Description

Homo sapiens miR-219a-2 stem-loop

Gene family

MIPF0000044; mir-219

Literature search

70 open access papers mention hsa-mir-219a-2
(247 sentences)

Stem-loop

   a   a       c     u   u     aa           uac a  c 
5'  cuc ggggcuu gccac gau gucca  cgcaauucuug   g gu u
    ||| ||||||| ||||| ||| |||||  |||||||||||   | || g
3'  ggg ccucgag cggug cua caggu  guguuaagagc   c cg c
   -   -       u     u   -     cg           caa -  g 

Deep sequencing

200519 reads, 142 reads per million, 118 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR [2]. The mature products were later verified in human [3]. Two hairpin precursor structures are predicted, mir-219-1 on chromosome 6 (MI0000296) and mir-219-2 on chromosome 9 (MI0000740) [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr9: 128392618-128392714 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000054088 ; MAPKAP1-005; intron 1

  OTTHUMT00000355310 ; MAPKAP1-017; intron 1

  OTTHUMT00000054096 ; MAPKAP1-013; intron 2

  OTTHUMT00000355307 ; MAPKAP1-014; intron 2

  OTTHUMT00000054094 ; MAPKAP1-011; intron 2

  OTTHUMT00000054092 ; MAPKAP1-009; intron 3

  OTTHUMT00000054091 ; MAPKAP1-008; intron 3

  OTTHUMT00000355308 ; MAPKAP1-015; intron 4

  OTTHUMT00000054090 ; MAPKAP1-007; intron 4

  OTTHUMT00000054086 ; MAPKAP1-003; intron 4

  ENST00000420643 ; MAPKAP1-005; intron 1

  ENST00000473837 ; MAPKAP1-017; intron 1

  ENST00000373497 ; MAPKAP1-202; intron 1

  ENST00000427078 ; MAPKAP1-013; intron 2

  ENST00000468896 ; MAPKAP1-014; intron 2

  ENST00000448439 ; MAPKAP1-011; intron 2

  ENST00000394063 ; MAPKAP1-203; intron 2

  ENST00000373498 ; MAPKAP1-009; intron 3

  ENST00000373503 ; MAPKAP1-008; intron 3

  ENST00000373511 ; MAPKAP1-015; intron 4

  ENST00000350766 ; MAPKAP1-007; intron 4

  ENST00000394060 ; MAPKAP1-003; intron 4

  ENST00000265960 ; MAPKAP1-201; intron 4

Clustered miRNAs

< 10kb from hsa-mir-219a-2

• hsa-mir-219b: chr9: 128392621-128392708 [+]
• hsa-mir-219a-2: chr9: 128392618-128392714 [-]

Database links

• EntrezGene:MIR219-2
• HGNC:MIR219A2
• RNAcentral:URS000075B0B0_9606
• miRBase Tracker:MI0000740

Mature sequence hsa-miR-219a-5p

• Accession: MIMAT0000276
• Previous IDs: hsa-miR-219
• Sequence: 19 - ugauuguccaaacgcaauucu - 39
• Deep sequencing: 3742 reads, 132 experiments
• Evidence: experimental; cloned [3]
• Database links:
  • RNAcentral:URS0000565C8D_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-219a-5p
  • miRDB:hsa-miR-219a-5p
  • microrna.org:hsa-miR-219a-5p

Mature sequence hsa-miR-219a-2-3p

• Accession: MIMAT0004675
• Sequence: 62 - agaauuguggcuggacaucugu - 83
• Deep sequencing: 198509 reads, 18 experiments
• Evidence: experimental; cloned [3]
• Database links:
  • RNAcentral:URS00004ACAAA_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-219a-2-3p
  • miRDB:hsa-miR-219a-2-3p
  • microrna.org:hsa-miR-219a-2-3p

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).