![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-199b |
||||||
Accession | MI0000714 (change log) | |||||
Symbol | MGI:Mir199b | |||||
Description | Mus musculus miR-199b stem-loop | |||||
Gene family | MIPF0000040; mir-199 | |||||
Literature search |
![]()
77 open access papers mention mmu-mir-199b | |||||
Stem-loop |
cca -auacc cu - c u c u ---- a 5' gagg ucca cc gucua ccagugu uagacuac ugu ca gg c |||| |||| || ||||| ||||||| |||||||| ||| || || 3' cucc gggu gg cggau gguuaca gucugaug aca gu cc u -gg cagauu cg u u c - u uaaa c |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
Mouse miR-199b is predicted based on homology with the previously identified human miR-199b (MI0000282) [1,2]. Landgraf et al. later showed that the 3' product is the predominant one [3]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-199b-5p |
|
Accession | MIMAT0000672 |
Previous IDs | mmu-miR-199b;mmu-miR-199b* |
Sequence |
26 - cccaguguuuagacuaccuguuc - 48 |
Deep sequencing | 438831 reads, 91 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-199b-3p |
|
Accession | MIMAT0004667 |
Previous IDs | mmu-miR-199b |
Sequence |
65 - acaguagucugcacauugguua - 86 |
Deep sequencing | 3631119 reads, 106 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|