Stem-loop sequence mmu-mir-200c

AccessionMI0000694 (change log)
Symbol MGI:Mir200c
DescriptionMus musculus miR-200c stem-loop
Gene family MIPF0000019; mir-8
Literature search

303 open access papers mention mmu-mir-200c
(2767 sentences)

Stem-loop
     cu    -      a        u   u   gg 
5' cc  cguc uuaccc gcaguguu ggg gcu  u
   ||  |||| |||||| |||||||| ||| |||  u
3' gg  guag aauggg cgucauaa cuc uga  g
     ag    u      c        u   -   gg 
Get sequence
Deep sequencing
326987 reads, 819 reads per million, 102 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-200c is predicted [3] based on homology to a cloned miR from human (MI0000650) [1]. Its expression in mouse was later verified independently [2,4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 124718322-124718390 [-]
sense
OTTMUST00000067268 ; RP24-297C1.9-001; intron 1
ENSMUST00000143765 ; Gm15884-001; intron 1
ENSMUST00000083528 ; Mir200c-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-200c
mmu-mir-200cchr6: 124718322-124718390 [-]
mmu-mir-141chr6: 124717914-124717985 [-]
Database links

Mature sequence mmu-miR-200c-5p

Accession MIMAT0004663
Previous IDsmmu-miR-200c*
Sequence

5 - 

cgucuuacccagcaguguuugg

 - 26

Get sequence
Deep sequencing117 reads, 28 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-200c-3p

Accession MIMAT0000657
Previous IDsmmu-miR-200c
Sequence

45 - 

uaauacugccggguaaugaugga

 - 67

Get sequence
Deep sequencing326859 reads, 102 experiments
Evidence experimental; cloned [2,4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).