![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-200c |
||||||
Accession | MI0000694 (change log) | |||||
Symbol | MGI:Mir200c | |||||
Description | Mus musculus miR-200c stem-loop | |||||
Gene family | MIPF0000019; mir-8 | |||||
Literature search |
![]()
303 open access papers mention mmu-mir-200c | |||||
Stem-loop |
cu - a u u gg 5' cc cguc uuaccc gcaguguu ggg gcu u || |||| |||||| |||||||| ||| ||| u 3' gg guag aauggg cgucauaa cuc uga g ag u c u - gg |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
Mouse mir-200c is predicted [3] based on homology to a cloned miR from human (MI0000650) [1]. Its expression in mouse was later verified independently [2,4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-200c-5p |
|
Accession | MIMAT0004663 |
Previous IDs | mmu-miR-200c* |
Sequence |
5 - cgucuuacccagcaguguuugg - 26 |
Deep sequencing | 117 reads, 28 experiments |
Evidence | experimental; cloned [4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-200c-3p |
|
Accession | MIMAT0000657 |
Previous IDs | mmu-miR-200c |
Sequence |
45 - uaauacugccggguaaugaugga - 67 |
Deep sequencing | 326859 reads, 102 experiments |
Evidence | experimental; cloned [2,4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:14573789
"Reduced accumulation of specific microRNAs in colorectal neoplasia"
Mol Cancer Res. 1:882-891(2003).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|