Stem-loop sequence mmu-mir-139

AccessionMI0000693 (change log)
Symbol MGI:Mir139
DescriptionMus musculus miR-139 stem-loop
Gene family MIPF0000117; mir-139
Literature search

44 open access papers mention mmu-mir-139
(482 sentences)

Stem-loop
   gug       -   u  a            g gg 
5'    uauucua cag gc cgugucuccagu u  c
      ||||||| ||| || |||||||||||| |  u
3'    augaggu guc cg gcgcagaggucg a  c
   -ca       u   c  -            g gg 
Get sequence
Deep sequencing
130435 reads, 2.24e+03 reads per million, 121 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 101475376-101475443 [+]
sense
ENSMUST00000163751 ; Pde2a-202; intron 2
ENSMUST00000084894 ; Pde2a-201; intron 2
ENSMUST00000166652 ; Pde2a-203; intron 2
Database links

Mature sequence mmu-miR-139-5p

Accession MIMAT0000656
Previous IDsmmu-miR-139
Sequence

7 - 

ucuacagugcacgugucuccag

 - 28

Get sequence
Deep sequencing80780 reads, 100 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-139-3p

Accession MIMAT0004662
Sequence

43 - 

uggagacgcggcccuguuggag

 - 64

Get sequence
Deep sequencing49545 reads, 85 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).