![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-200c |
||||||
Accession | MI0000650 (change log) | |||||
Symbol | HGNC:MIR200C | |||||
Description | Homo sapiens miR-200c stem-loop | |||||
Gene family | MIPF0000019; mir-8 | |||||
Literature search |
![]()
729 open access papers mention hsa-mir-200c | |||||
Stem-loop |
cu - a u u ggu 5' cc cguc uuaccc gcaguguu ggg gc u || |||| |||||| |||||||| ||| || 3' gg guag aauggg cgucauaa cuc ug g ag u c u - agg |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-200c-5p |
|
Accession | MIMAT0004657 |
Previous IDs | hsa-miR-200c* |
Sequence |
5 - cgucuuacccagcaguguuugg - 26 |
Deep sequencing | 2360 reads, 79 experiments |
Evidence | experimental; cloned [3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-200c-3p |
|
Accession | MIMAT0000617 |
Previous IDs | hsa-miR-200c |
Sequence |
44 - uaauacugccggguaaugaugga - 66 |
Deep sequencing | 2053151 reads, 158 experiments |
Evidence | experimental; cloned [1-4], Northern [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:14573789
"Reduced accumulation of specific microRNAs in colorectal neoplasia"
Mol Cancer Res. 1:882-891(2003).
|
2 |
PMID:15183728
"Human embryonic stem cells express a unique set of microRNAs"
Dev Biol. 270:488-498(2004).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|