Stem-loop sequence rno-mir-323

AccessionMI0000591 (change log)
DescriptionRattus norvegicus miR-323 stem-loop
Gene family MIPF0000018; mir-154
Literature search

7 open access papers mention rno-mir-323
(19 sentences)

Stem-loop 
   ---uu      u g        g u     gcgc  u    uca 
5'      gguacu g agagaggu g ccgug    gu cgcu   u
        |||||| | |||||||| | |||||    || ||||    
3'      cuaugg c uuucucca c ggcac    ca gcgg   u
   cuaau      - g        g u     auua  c    uau
Get sequence
Deep sequencing
82257 reads, 54.1 reads per million, 364 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133861199-133861284 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-323
rno-mir-379chr6: 133857700-133857784 [+]
rno-mir-411chr6: 133858849-133858924 [+]
rno-mir-299bchr6: 133859295-133859412 [-]
rno-mir-299achr6: 133859324-133859386 [+]
rno-mir-3579chr6: 133860473-133860585 [-]
rno-mir-380chr6: 133860490-133860566 [+]
rno-mir-323chr6: 133861199-133861284 [+]
rno-mir-758chr6: 133861498-133861575 [+]
rno-mir-329chr6: 133862168-133862264 [+]
rno-mir-494chr6: 133864370-133864452 [+]
rno-mir-679chr6: 133864564-133864700 [+]
rno-mir-1193chr6: 133864698-133864817 [+]
rno-mir-666chr6: 133866523-133866621 [+]
rno-mir-543chr6: 133866660-133866739 [+]
rno-mir-495chr6: 133868288-133868367 [+]
rno-mir-667chr6: 133869570-133869661 [+]
Database links

Mature sequence rno-miR-323-5p

Accession MIMAT0004637
Previous IDsrno-miR-323*
Sequence

16 -  

aggugguccguggcgcguucgc

 - 37

Get sequence
Deep sequencing3429 reads, 127 experiments
Evidence experimental; cloned [3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-323-3p

Accession MIMAT0000550
Previous IDsrno-miR-323
Sequence

51 -  

cacauuacacggucgaccucu

 - 71

Get sequence
Deep sequencing78820 reads, 361 experiments
Evidence experimental; cloned [1-3], Northern [1], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).