![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-let-7a-1 |
||||||||
Accession | MI0000556 (change log) | |||||||
Symbol | MGI:Mirlet7a-1 | |||||||
Description | Mus musculus let-7a-1 stem-loop | |||||||
Gene family | MIPF0000002; let-7 | |||||||
Literature search |
![]()
484 open access papers mention mmu-let-7a-1 | |||||||
Stem-loop |
u g u gu uuagggucacac 5' ucacu uggga gag aguagguuguauaguu c ||||| ||||| ||| |||||||||||||||| c 3' agugg auccu uuc ucaucuaacauaucaa a u a - ug uagagggucacc |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence mmu-let-7a-5p |
|
Accession | MIMAT0000521 |
Previous IDs | mmu-let-7a |
Sequence |
13 - ugagguaguagguuguauaguu - 34 |
Deep sequencing | 249539481 reads, 109 experiments |
Evidence | experimental; cloned [1-4], Illumina [5,7] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-let-7a-1-3p |
|
Accession | MIMAT0004620 |
Previous IDs | mmu-let-7a*;mmu-let-7a-1* |
Sequence |
64 - cuauacaaucuacugucuuucc - 85 |
Deep sequencing | 10150 reads, 105 experiments |
Evidence | experimental; cloned [4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 | |
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|