Stem-loop sequence mmu-mir-196a-2

Accession

MI0000553 (change log)

Previous IDs

mmu-mir-196-2

Symbol

MGI:Mir196a-2

Description

Mus musculus miR-196a-2 stem-loop

Gene family

MIPF0000031; mir-196

Literature search

66 open access papers mention mmu-mir-196a-2
(581 sentences)

Stem-loop

   a     uc                  a          a ug   
5'  gcuga  uguggcuuagguaguuuc uguuguuggg u  ag 
    |||||  |||||||||||||||||| |||||||||| |  | u
3'  ugacu  acauugaguccgucaaag acaacggcuc a  uu 
   c     --                  a          a gu   

Deep sequencing

570880 reads, 1.88e+03 reads per million, 94 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr15: 102973350-102973434 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000096497 ; Hoxc5-002; intron 1

  ENSMUST00000174869 ; Hoxc5-002; intron 1

  ENSMUST00000083554 ; Mir196a-2-201; exon 1

Database links

• EntrezGene:Mirn196a-2
• MGI:Mir196a-2
• RNAcentral:URS000075E574_10090
• miRBase Tracker:MI0000553

Mature sequence mmu-miR-196a-5p

• Accession: MIMAT0000518
• Previous IDs: mmu-miR-196a
• Sequence: 16 - uagguaguuucauguuguuggg - 37
• Deep sequencing: 1133875 reads, 90 experiments
• Evidence: experimental; cloned [1,3], Illumina [4-5]
• Database links:
  • RNAcentral:URS00000DA6A7_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-196a-5p
  • miRDB:mmu-miR-196a-5p
  • microrna.org:mmu-miR-196a-5p

Mature sequence mmu-miR-196a-2-3p

• Accession: MIMAT0004618
• Previous IDs: mmu-miR-196a*;mmu-miR-196a-2*
• Sequence: 52 - ucggcaacaagaaacugccuga - 73
• Deep sequencing: 1080 reads, 37 experiments
• Evidence: experimental; cloned [3], Illumina [4-5]
• Database links:
  • RNAcentral:URS00005120E9_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-196a-2-3p
  • miRDB:mmu-miR-196a-2-3p
  • microrna.org:mmu-miR-196a-2-3p

References

1. PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2. PMID:15105502 "MicroRNA-directed cleavage of HOXB8 mRNA" Yekta S, Shih IH, Bartel DP Science. 304:594-596(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).