Stem-loop sequence mmu-mir-34b

Accession

MI0000404 (change log)

Symbol

MGI:Mir34b

Description

Mus musculus miR-34b stem-loop

Gene family

MIPF0000039; mir-34

Literature search

208 open access papers mention mmu-mir-34b
(1234 sentences)

Stem-loop

        cg    -gua       uaa    c       -   g 
5' gugcu  guuu    ggcagug   uuag ugauugu agu c
   |||||  ||||    |||||||   |||| ||||||| ||| g
3' cacgg  caaa    ccgucac   aauc acuaaca ucg g
        aa    acua       cuc    -       g   u 

Deep sequencing

5782618 reads, 3.01e+04 reads per million, 109 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells [1], and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MI0000403), miR-34b (MI0000404) and miR-34a (MI0000584) to clarify homology with human sequences. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr9: 51103562-51103645 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from mmu-mir-34b

• mmu-mir-34b: chr9: 51103562-51103645 [-]
• mmu-mir-34c: chr9: 51103034-51103110 [-]

Database links

• EntrezGene:Mirn34b
• MGI:Mir34b
• RNAcentral:URS000072DC85_10090
• miRBase Tracker:MI0000404

Mature sequence mmu-miR-34b-5p

• Accession: MIMAT0000382
• Previous IDs: mmu-miR-34b
• Sequence: 14 - aggcaguguaauuagcugauugu - 36
• Deep sequencing: 5764887 reads, 106 experiments
• Evidence: experimental; cloned [1-2], Illumina [3-4]
• Database links:
  • RNAcentral:URS000037E0D9_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-34b-5p
  • miRDB:mmu-miR-34b-5p
  • microrna.org:mmu-miR-34b-5p

Mature sequence mmu-miR-34b-3p

• Accession: MIMAT0004581
• Sequence: 51 - aaucacuaacuccacugccauc - 72
• Deep sequencing: 17707 reads, 85 experiments
• Evidence: experimental; cloned [2], Illumina [3-4]
• Database links:
  • RNAcentral:URS00004C43E8_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-34b-3p
  • miRDB:mmu-miR-34b-3p
  • microrna.org:mmu-miR-34b-3p

References

1. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).