Stem-loop sequence hsa-mir-223

Accession

MI0000300 (change log)

Symbol

HGNC:MIR223

Description

Homo sapiens miR-223 stem-loop

Gene family

MIPF0000067; mir-223

Literature search

400 open access papers mention hsa-mir-223
(2675 sentences)

Stem-loop

   c    ccuccu   -     a    cc u              gaguug       cau 
5'  cugg      gca gugcc cgcu  g guauuugacaagcu      gacacuc   g
    ||||      ||| ||||| ||||  | ||||||||||||||      |||||||   u
3'  gacc      cgu cacgg guga  c cauaaacuguuuga      cugugag   g
   -    ---auu   a     c    ac c              ------       aug 

Deep sequencing

180865 reads, 1.04e+03 reads per million, 142 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chrX: 66018870-66018979 [+]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR223
• HGNC:MIR223
• RNAcentral:URS000037EC34_9606
• miRBase Tracker:MI0000300

Mature sequence hsa-miR-223-5p

• Accession: MIMAT0004570
• Previous IDs: hsa-miR-223*
• Sequence: 26 - cguguauuugacaagcugaguu - 47
• Deep sequencing: 13274 reads, 105 experiments
• Evidence: experimental; cloned [2]
• Database links:
  • RNAcentral:URS0000485CBB_9606
• Predicted targets:
  • TargetMiner:hsa-miR-223-5p
  • TargetScanVert:hsa-miR-223-5p
  • miRDB:hsa-miR-223-5p
  • microrna.org:hsa-miR-223-5p

Mature sequence hsa-miR-223-3p

• Accession: MIMAT0000280
• Previous IDs: hsa-miR-223
• Sequence: 68 - ugucaguuugucaaauacccca - 89
• Deep sequencing: 167585 reads, 139 experiments
• Evidence: experimental; cloned [2]
• Database links:
  • RNAcentral:URS00000B7E30_9606
• Predicted targets:
  • TargetMiner:hsa-miR-223-3p
  • TargetScanVert:hsa-miR-223-3p
  • miRDB:hsa-miR-223-3p
  • microrna.org:hsa-miR-223-3p

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).