![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-183 |
||||||||
Accession | MI0000225 (change log) | |||||||
Symbol | MGI:Mir183 | |||||||
Description | Mus musculus miR-183 stem-loop | |||||||
Gene family | MIPF0000066; mir-183 | |||||||
Literature search |
![]()
106 open access papers mention mmu-mir-183 | |||||||
Stem-loop |
g --ac ga -- ac 5' cugu uauggc uggua auucacug uga a |||| |||||| ||||| |||||||| ||| 3' gaca auaccg gccau uaagugac acu g a ggaa -- ug cu |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence mmu-miR-183-5p |
|
Accession | MIMAT0000212 |
Previous IDs | mmu-miR-183 |
Sequence |
6 - uauggcacugguagaauucacu - 27 |
Deep sequencing | 541024 reads, 101 experiments |
Evidence | experimental; cloned [1-3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-183-3p |
|
Accession | MIMAT0004539 |
Previous IDs | mmu-miR-183* |
Sequence |
45 - gugaauuaccgaagggccauaa - 66 |
Deep sequencing | 5377 reads, 80 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
2 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|