Stem-loop sequence mmu-mir-10b

Accession

MI0000221 (change log)

Symbol

MGI:Mir10b

Description

Mus musculus miR-10b stem-loop

Gene family

MIPF0000033; mir-10

Literature search

133 open access papers mention mmu-mir-10b
(849 sentences)

Stem-loop

        a    g     c          -ug  ac 
5' uauau cccu uagaa cgaauuugug   gu  c
   ||||| |||| ||||| ||||||||||   ||   
3' auaua gggg aucuu gcuuagacac   ua  c
        a    -     a          uga  ca 

Deep sequencing

18876736 reads, 2.29e+04 reads per million, 110 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

The sequence of mouse miR-10b, as reported by Lagos-Quintana et al. [1], is offset by 2 nt in the 3' direction with respect to sequences cloned from human (MI0000267) and zebrafish (MI0001364). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr2: 74726070-74726137 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000040120 ; Hoxd3-001; intron 1

  OTTMUST00000040121 ; Hoxd3-002; intron 5

  ENSMUST00000111983 ; Hoxd3-001; intron 1

  ENSMUST00000083566 ; Mir10b-201; exon 1

  ENSMUST00000047904 ; Hoxd3-201; intron 4

  ENSMUST00000144040 ; Hoxd3-002; intron 5

Database links

• EntrezGene:Mir10b
• MGI:Mir10b
• RNAcentral:URS000075A57E_10090
• Rfam:mir-10
• miRBase Tracker:MI0000221

Mature sequence mmu-miR-10b-5p

• Accession: MIMAT0000208
• Previous IDs: mmu-miR-10b
• Sequence: 5 - uacccuguagaaccgaauuugug - 27
• Deep sequencing: 18866151 reads, 109 experiments
• Evidence: experimental; cloned [1-2], Illumina [3-4]
• Database links:
  • RNAcentral:URS000058760A_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-10b-5p
  • miRDB:mmu-miR-10b-5p
  • microrna.org:mmu-miR-10b-5p

Mature sequence mmu-miR-10b-3p

• Accession: MIMAT0004538
• Previous IDs: mmu-miR-10b*
• Sequence: 45 - cagauucgauucuaggggaaua - 66
• Deep sequencing: 10582 reads, 65 experiments
• Evidence: experimental; cloned [2], Illumina [3-4]
• Database links:
  • RNAcentral:URS00005EF5AA_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-10b-3p
  • miRDB:mmu-miR-10b-3p
  • microrna.org:mmu-miR-10b-3p

References

1. PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).