![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-154 |
||||||||||||||||||||||||||||||||
Accession | MI0000176 (change log) | |||||||||||||||||||||||||||||||
Symbol | MGI:Mir154 | |||||||||||||||||||||||||||||||
Description | Mus musculus miR-154 stem-loop | |||||||||||||||||||||||||||||||
Gene family | MIPF0000018; mir-154 | |||||||||||||||||||||||||||||||
Literature search |
![]()
24 open access papers mention mmu-mir-154 | |||||||||||||||||||||||||||||||
Stem-loop |
u ugcc - uuu 5' gaagauagguua ccgugu uucg c a |||||||||||| |||||| |||| | u 3' uuuuuauccagu ggcaca aagc g u u uacu a ugc |
|||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-154-5p |
|
Accession | MIMAT0000164 |
Previous IDs | mmu-miR-154 |
Sequence |
6 - uagguuauccguguugccuucg - 27 |
Deep sequencing | 12000 reads, 68 experiments |
Evidence | experimental; cloned [1,3-4], PCR [2], Illumina [5-6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-154-3p |
|
Accession | MIMAT0004537 |
Previous IDs | mmu-miR-154* |
Sequence |
42 - aaucauacacgguugaccuauu - 63 |
Deep sequencing | 19993 reads, 68 experiments |
Evidence | experimental; cloned [4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:15310658
"A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain"
Genome Res. 14:1741-1748(2004).
|
3 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|