Stem-loop sequence mmu-mir-151

Accession

MI0000173 (change log)

Symbol

MGI:Mir151

Description

Mus musculus miR-151 stem-loop

Gene family

MIPF0000057; mir-28

Literature search

34 open access papers mention mmu-mir-151
(122 sentences)

Stem-loop

       c            ca          u uc 
5' ccug ccucgaggagcu  cagucuagua g  u
   |||| ||||||||||||  |||||||||| |  c
3' ggac ggaguuccucgg  gucagaucau c  c
       a            -a          c cu 

Deep sequencing

726118 reads, 1.26e+03 reads per million, 107 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr15: 73254815-73254882 [-]
• Overlapping transcripts:

  sense

  ENSMUST00000110036 ; Ptk2-201; intron 22

  ENSMUST00000170939 ; Ptk2-202; intron 23

Database links

• EntrezGene:Mir151
• MGI:Mir151
• RNAcentral:URS000075B561_10090
• miRBase Tracker:MI0000173

Mature sequence mmu-miR-151-5p

• Accession: MIMAT0004536
• Sequence: 8 - ucgaggagcucacagucuagu - 28
• Deep sequencing: 220327 reads, 107 experiments
• Evidence: experimental; cloned [2], Illumina [3-4]
• Database links:
  • RNAcentral:URS00005F8E5B_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-151-5p
  • miRDB:mmu-miR-151-5p
  • microrna.org:mmu-miR-151-5p

Mature sequence mmu-miR-151-3p

• Accession: MIMAT0000161
• Previous IDs: mmu-miR-151
• Sequence: 43 - cuagacugaggcuccuugagg - 63
• Deep sequencing: 505788 reads, 107 experiments
• Evidence: experimental; cloned [1-2], Illumina [3-4]
• Database links:
  • RNAcentral:URS0000520A95_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-151-3p
  • miRDB:mmu-miR-151-3p
  • microrna.org:mmu-miR-151-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).