Stem-loop sequence mmu-let-7g

Accession

MI0000137 (change log)

Previous IDs

mmu-let-7gL

Symbol

MGI:Mirlet7g

Description

Mus musculus let-7g stem-loop

Gene family

MIPF0000002; let-7

Literature search

414 open access papers mention mmu-let-7g
(2268 sentences)

Stem-loop

     a   u        a            ugagg    -a  a    a 
5' cc ggc gagguagu guuuguacaguu     gucu  ug uacc c
   || ||| |||||||| ||||||||||||     ||||  || ||||  
3' gg ccg uuccguca cggacaugucaa     uaga  ac augg c
     a   -        c            -----    gg  -    c 

Deep sequencing

87987434 reads, 1.95e+05 reads per million, 107 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence reported in [1] has a 3' terminal A residue, which is incompatible with the reported precursor sequence from [1] and in this entry. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr9: 106178840-106178927 [+]
• Overlapping transcripts:

  sense

  ENSMUST00000020490 ; Wdr82-201; intron 2

Database links

• EntrezGene:Mirnlet7g
• MGI:Mirlet7g
• RNAcentral:URS00000B0351_10090
• Rfam:let-7
• miRBase Tracker:MI0000137

Mature sequence mmu-let-7g-5p

• Accession: MIMAT0000121
• Previous IDs: mmu-let-7g
• Sequence: 7 - ugagguaguaguuuguacaguu - 28
• Deep sequencing: 87985534 reads, 107 experiments
• Evidence: experimental; cloned [1-4], Illumina [5-6]
• Database links:
  • RNAcentral:URS00004AFF8D_10090
• Predicted targets:
  • TargetScanVert:mmu-let-7g-5p
  • miRDB:mmu-let-7g-5p
  • microrna.org:mmu-let-7g-5p

Mature sequence mmu-let-7g-3p

• Accession: MIMAT0004519
• Previous IDs: mmu-let-7g*
• Sequence: 63 - acuguacaggccacugccuugc - 84
• Deep sequencing: 1878 reads, 90 experiments
• Evidence: experimental; cloned [4], Illumina [5-6]
• Database links:
  • RNAcentral:URS0000595A16_10090
• Predicted targets:
  • TargetScanVert:mmu-let-7g-3p
  • miRDB:mmu-let-7g-3p
  • microrna.org:mmu-let-7g-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).