![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-let-7g |
|||||
Accession | MI0000137 (change log) | ||||
Previous IDs | mmu-let-7gL | ||||
Symbol | MGI:Mirlet7g | ||||
Description | Mus musculus let-7g stem-loop | ||||
Gene family | MIPF0000002; let-7 | ||||
Literature search |
![]()
414 open access papers mention mmu-let-7g | ||||
Stem-loop |
a u a ugagg -a a a 5' cc ggc gagguagu guuuguacaguu gucu ug uacc c || ||| |||||||| |||||||||||| |||| || |||| 3' gg ccg uuccguca cggacaugucaa uaga ac augg c a - c ----- gg - c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
The mature sequence reported in [1] has a 3' terminal A residue, which is incompatible with the reported precursor sequence from [1] and in this entry. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-let-7g-5p |
|
Accession | MIMAT0000121 |
Previous IDs | mmu-let-7g |
Sequence |
7 - ugagguaguaguuuguacaguu - 28 |
Deep sequencing | 87985534 reads, 107 experiments |
Evidence | experimental; cloned [1-4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-let-7g-3p |
|
Accession | MIMAT0004519 |
Previous IDs | mmu-let-7g* |
Sequence |
63 - acuguacaggccacugccuugc - 84 |
Deep sequencing | 1878 reads, 90 experiments |
Evidence | experimental; cloned [4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 | |
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|