Stem-loop sequence hsa-mir-24-2

Accession

MI0000081 (change log)

Symbol

HGNC:MIR24-2

Description

Homo sapiens miR-24-2 stem-loop

Gene family

MIPF0000041; mir-24

Literature search

343 open access papers mention hsa-mir-24-2
(2123 sentences)

Stem-loop

        cc   cg   -cu         --aa      u 
5' cucug  ucc  ugc   acugagcug    acacag u
   |||||  |||  |||   |||||||||    |||||| g
3' gggac  agg  acg   ugacucggu    uguguu g
        -a   --   acu         caca      u 

Deep sequencing

1987325 reads, 3.75e+03 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

mir-24-2 was identified independently by two groups. This sequence was named miR-24 precursor-19 in reference [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr19: 13836287-13836359 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-24-2

• hsa-mir-23a: chr19: 13836587-13836659 [-]
• hsa-mir-27a: chr19: 13836440-13836517 [-]
• hsa-mir-24-2: chr19: 13836287-13836359 [-]

Database links

• EntrezGene:MIR24-2
• HGNC:MIR24-2
• RNAcentral:URS00000FFC8B_9606
• miRBase Tracker:MI0000081

Mature sequence hsa-miR-24-2-5p

• Accession: MIMAT0004497
• Previous IDs: hsa-miR-24-2*
• Sequence: 13 - ugccuacugagcugaaacacag - 34
• Deep sequencing: 18967 reads, 153 experiments
• Evidence: experimental; cloned [6]
• Database links:
  • RNAcentral:URS00001DEE11_9606
• Predicted targets:
  • TargetMiner:hsa-miR-24-2-5p
  • TargetScanVert:hsa-miR-24-2-5p
  • miRDB:hsa-miR-24-2-5p
  • microrna.org:hsa-miR-24-2-5p

Mature sequence hsa-miR-24-3p

• Accession: MIMAT0000080
• Previous IDs: hsa-miR-24
• Sequence: 50 - uggcucaguucagcaggaacag - 71
• Deep sequencing: 3941768 reads, 159 experiments
• Evidence: experimental; cloned [1,4-7], Northern [1], Illumina [8]
• Database links:
  • RNAcentral:URS000059273E_9606
• Predicted targets:
  • TargetMiner:hsa-miR-24-3p
  • TargetScanVert:hsa-miR-24-3p
  • miRDB:hsa-miR-24-3p
  • microrna.org:hsa-miR-24-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
4. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
6. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
8. PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).