Stem-loop sequence hsa-mir-22

Accession

MI0000078 (change log)

Symbol

HGNC:MIR22

Description

Homo sapiens miR-22 stem-loop

Gene family

MIPF0000053; mir-22

Literature search

294 open access papers mention hsa-mir-22
(1719 sentences)

Stem-loop

      u   cc               -     a      u  ccu 
5' ggc gag  gcaguaguucuucag uggca gcuuua gu   g
   ||| |||  ||||||||||||||| ||||| |||||| ||   a
3' ccg cuc  cguugucaagaaguu accgu cgaaau cg   c
      u   -c               g     -      -  acc 

Deep sequencing

1291263 reads, 3.83e+03 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr17: 1713903-1713987 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000207108 ; SMYD4-001; intron 3

  OTTHUMT00000438278 ; SMYD4-005; intron 3

  OTTHUMT00000318358 ; SMYD4-003; intron 3

  OTTHUMT00000438279 ; SMYD4-007; intron 3

  ENST00000305513 ; SMYD4-001; intron 3

  ENST00000570368 ; SMYD4-005; intron 3

  ENST00000571854 ; SMYD4-003; intron 3

  ENST00000573937 ; SMYD4-007; intron 3

Database links

• EntrezGene:MIR22
• HGNC:MIR22
• RNAcentral:URS00003A4D14_9606
• miRBase Tracker:MI0000078

Mature sequence hsa-miR-22-5p

• Accession: MIMAT0004495
• Previous IDs: hsa-miR-22*
• Sequence: 15 - aguucuucaguggcaagcuuua - 36
• Deep sequencing: 36288 reads, 153 experiments
• Evidence: experimental; cloned [4]
• Database links:
  • RNAcentral:URS0000142DC3_9606
• Predicted targets:
  • TargetMiner:hsa-miR-22-5p
  • TargetScanVert:hsa-miR-22-5p
  • miRDB:hsa-miR-22-5p
  • microrna.org:hsa-miR-22-5p

Mature sequence hsa-miR-22-3p

• Accession: MIMAT0000077
• Previous IDs: hsa-miR-22
• Sequence: 53 - aagcugccaguugaagaacugu - 74
• Deep sequencing: 1254963 reads, 159 experiments
• Evidence: experimental; cloned [1,3-5], Northern [1], Illumina [6]
• Database links:
  • RNAcentral:URS0000096022_9606
• Predicted targets:
  • TargetMiner:hsa-miR-22-3p
  • TargetScanVert:hsa-miR-22-3p
  • miRDB:hsa-miR-22-3p
  • microrna.org:hsa-miR-22-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
6. PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).