![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-let-7b |
||||||||
Accession | MI0000063 (change log) | |||||||
Previous IDs | hsa-let-7bL | |||||||
Symbol | HGNC:MIRLET7B | |||||||
Description | Homo sapiens let-7b stem-loop | |||||||
Gene family | MIPF0000002; let-7 | |||||||
Literature search |
![]()
1157 open access papers mention hsa-let-7b | |||||||
Stem-loop |
u ucagggcagugaug 5' cgggg gagguaguagguugugugguu u ||||| ||||||||||||||||||||| 3' guccc uuccgucauccaacauaucaa u - uagaaggcuccccg |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence hsa-let-7b-5p |
|
Accession | MIMAT0000063 |
Previous IDs | hsa-let-7b |
Sequence |
6 - ugagguaguagguugugugguu - 27 |
Deep sequencing | 41499458 reads, 159 experiments |
Evidence | experimental; cloned [1,3-5], Northern [1] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-let-7b-3p |
|
Accession | MIMAT0004482 |
Previous IDs | hsa-let-7b* |
Sequence |
60 - cuauacaaccuacugccuuccc - 81 |
Deep sequencing | 19672 reads, 153 experiments |
Evidence | experimental; cloned [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:11679670
"Identification of novel genes coding for small expressed RNAs"
Science. 294:853-858(2001).
|
2 |
PMID:14573789
"Reduced accumulation of specific microRNAs in colorectal neoplasia"
Mol Cancer Res. 1:882-891(2003).
|
3 |
PMID:15325244
"Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
Biochem Biophys Res Commun. 322:403-410(2004).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|