Stem-loop sequence mmu-mir-743a

Accession

MI0005207 (change log)

Previous IDs

mmu-mir-743

Symbol

MGI:Mir743

Description

Mus musculus miR-743a stem-loop

Gene family

MIPF0000386; mir-743

Literature search

10 open access papers mention mmu-mir-743a
(32 sentences)

Stem-loop

   --  g       a      c  g    guuu 
5'   cu uauucag uuggug cu ucau    a
     || ||||||| |||||| || ||||     
3'   ga augaguc aaccac ga agua    u
   au  g       g      a  a    agaa 

Deep sequencing

47284 reads, 2.31e+03 reads per million, 45 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chrX: 66776757-66776818 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from mmu-mir-743a

• mmu-mir-883a: chrX: 66780758-66780833 [-]
• mmu-mir-742: chrX: 66780373-66780437 [-]
• mmu-mir-743b: chrX: 66777256-66777332 [-]
• mmu-mir-743a: chrX: 66776757-66776818 [-]

Database links

• EntrezGene:Mir743
• MGI:Mir743
• RNAcentral:URS000075DEEC_10090
• miRBase Tracker:MI0005207

Mature sequence mmu-miR-743a-5p

• Accession: MIMAT0017263
• Previous IDs: mmu-miR-743a*
• Sequence: 4 - uauucagauuggugccugucau - 25
• Deep sequencing: 3334 reads, 21 experiments
• Evidence: experimental; Illumina [4]
• Database links:
  • RNAcentral:URS000013BFCF_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-743a-5p
  • miRDB:mmu-miR-743a-5p

Mature sequence mmu-miR-743a-3p

• Accession: MIMAT0004238
• Previous IDs: mmu-miR-743;mmu-miR-743a
• Sequence: 38 - gaaagacaccaagcugaguaga - 59
• Deep sequencing: 43949 reads, 45 experiments
• Evidence: experimental; cloned [1-2], Illumina [3-4]
• Database links:
  • RNAcentral:URS00003ABBF3_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-743a-3p
  • miRDB:mmu-miR-743a-3p
  • microrna.org:mmu-miR-743a-3p

References

1. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).