Stem-loop sequence mmu-mir-744

Accession

MI0004124 (change log)

Symbol

MGI:Mir744

Description

Mus musculus miR-744 stem-loop

Gene family

MIPF0000431; mir-744

Literature search

21 open access papers mention mmu-mir-744
(140 sentences)

Stem-loop

          c     gc    c   -   u       gucuuacugacgguu 
5' ggcuggg aaggu  gggg uag ggc aacagca               u
   ||||||| |||||  |||| ||| ||| |||||||               c
3' cuggcuc uucca  cucc auc ccg uugucgu               c
          a     -a    a   a   -       acacacaccaaaggu 

Deep sequencing

687020 reads, 1.49e+03 reads per million, 107 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

mir-744 was also named mir-803 in Takada et al., supplementary information [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr11: 65734733-65734832 [-]
• Overlapping transcripts:

  sense

  OTTMUST00000013142 ; Map2k4-001; intron 2

  OTTMUST00000013145 ; Map2k4-004; intron 2

  OTTMUST00000013146 ; Map2k4-005; intron 3

  OTTMUST00000013143 ; Map2k4-002; intron 3

  OTTMUST00000013144 ; Map2k4-003; intron 4

  ENSMUST00000140301 ; Map2k4-001; intron 2

  ENSMUST00000138093 ; Map2k4-004; intron 2

  ENSMUST00000046963 ; Map2k4-005; intron 3

  ENSMUST00000130009 ; Map2k4-002; intron 3

  ENSMUST00000152096 ; Map2k4-003; intron 4

Database links

• EntrezGene:Mir744
• MGI:Mir744
• RNAcentral:URS00006291B9_10090
• miRBase Tracker:MI0004124

Mature sequence mmu-miR-744-5p

• Accession: MIMAT0004187
• Previous IDs: mmu-miR-744
• Sequence: 13 - ugcggggcuagggcuaacagca - 34
• Deep sequencing: 685392 reads, 107 experiments
• Evidence: experimental; miRAP-cloned [1], cloned [2-3], 454 [4], Illumina [5-6]
• Database links:
  • RNAcentral:URS00002ED61F_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-744-5p
  • miRDB:mmu-miR-744-5p
  • microrna.org:mmu-miR-744-5p

Mature sequence mmu-miR-744-3p

• Accession: MIMAT0004820
• Previous IDs: mmu-miR-744*
• Sequence: 70 - cuguugccacuaaccucaaccu - 91
• Deep sequencing: 1615 reads, 74 experiments
• Evidence: experimental; cloned [3], Illumina [5-6]
• Database links:
  • RNAcentral:URS00005FAA14_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-744-3p
  • miRDB:mmu-miR-744-3p
  • microrna.org:mmu-miR-744-3p

References

1. PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).
2. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
5. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).