![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-674 |
|||||
Accession | MI0004611 (change log) | ||||
Symbol | MGI:Mir674 | ||||
Description | Mus musculus miR-674 stem-loop | ||||
Gene family | MIPF0000394; mir-674 | ||||
Literature search |
![]()
10 open access papers mention mmu-mir-674 | ||||
Stem-loop |
cu u u u ca g ag u 5' ggc ag ca caccc gagccuug cugagaugggagu gugua gc c ||| || || ||||| |||||||| ||||||||||||| ||||| || 3' ucg uc gu guggg cucggaac gacucuacccucg cacgu ug a ac - - - aa a -a g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
Landgraf et al. show that the 5' miRNA product is the predominant one [4]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-674-5p |
|
Accession | MIMAT0003740 |
Previous IDs | mmu-miR-674-5p;mmu-miR-674 |
Sequence |
25 - gcacugagaugggaguggugua - 46 |
Deep sequencing | 30637 reads, 104 experiments |
Evidence | experimental; MPSS [1], cloned [2,4], miRAP-cloned [3], Illumina [5-6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-674-3p |
|
Accession | MIMAT0003741 |
Previous IDs | mmu-miR-674-3p;mmu-miR-674* |
Sequence |
60 - cacagcucccaucucagaacaa - 81 |
Deep sequencing | 18147 reads, 106 experiments |
Evidence | experimental; MPSS [1], cloned [2,4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
2 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
3 |
PMID:16973894
"Mouse microRNA profiles determined with a new and sensitive cloning method"
Nucleic Acids Res. 34:e115(2006).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|