![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-450b |
||||||||||||||||
Accession | MI0004705 (change log) | |||||||||||||||
Symbol | MGI:Mir450b | |||||||||||||||
Description | Mus musculus miR-450b stem-loop | |||||||||||||||
Gene family | MIPF0000128; mir-450 | |||||||||||||||
Literature search |
![]()
7 open access papers mention mmu-mir-450b | |||||||||||||||
Stem-loop |
uuu u g auaa 5' gauacagaauuau ugcag auguuccu aauac c ||||||||||||| ||||| |||||||| ||||| a 3' cuauguuuuaaua acguu uacaaggg uuaug u cgu u - cgaa |
|||||||||||||||
Deep sequencing |
| |||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||
Genome context |
|
|||||||||||||||
Clustered miRNAs |
|
|||||||||||||||
Database links |
|
Mature sequence mmu-miR-450b-5p |
|
Accession | MIMAT0003511 |
Previous IDs | mmu-miR-450b |
Sequence |
14 - uuuugcaguauguuccugaaua - 35 |
Deep sequencing | 18730 reads, 95 experiments |
Evidence | experimental; MPSS [1], cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-450b-3p |
|
Accession | MIMAT0003512 |
Previous IDs | mmu-miR-450b* |
Sequence |
50 - auugggaacauuuugcaugcau - 71 |
Deep sequencing | 6508 reads, 99 experiments |
Evidence | experimental; MPSS [1], cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|