![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-501 |
||||||||||||
Accession | MI0004703 (change log) | |||||||||||
Symbol | MGI:Mir501 | |||||||||||
Description | Mus musculus miR-501 stem-loop | |||||||||||
Gene family | MIPF0000139; mir-500 | |||||||||||
Literature search |
![]()
12 open access papers mention mmu-mir-501 | |||||||||||
Stem-loop |
- --- -u c uc u u aaaa uau 5' cuuc ugc uc gcucauc ucucuaa cuuug ccc gggug ugc u |||| ||| || ||||||| ||||||| ||||| ||| ||||| ||| u 3' gagg acg ag cgagugg agggguu ggaac ggg cccac acg g u ucu uc a ua - - -gua uau |
|||||||||||
Deep sequencing |
| |||||||||||
Confidence |
Annotation confidence: high
| |||||||||||
Genome context |
|
|||||||||||
Clustered miRNAs |
|
|||||||||||
Database links |
|
Mature sequence mmu-miR-501-5p |
|
Accession | MIMAT0003508 |
Previous IDs | mmu-miR-501 |
Sequence |
24 - aauccuuugucccugggugaaa - 45 |
Deep sequencing | 3668 reads, 94 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-501-3p |
|
Accession | MIMAT0003509 |
Previous IDs | mmu-miR-501* |
Sequence |
61 - aaugcacccgggcaaggauuug - 82 |
Deep sequencing | 63462 reads, 105 experiments |
Evidence | experimental; MPSS [1], cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|