Stem-loop sequence mmu-mir-501

AccessionMI0004703 (change log)
Symbol MGI:Mir501
DescriptionMus musculus miR-501 stem-loop
Gene family MIPF0000139; mir-500
Literature search

12 open access papers mention mmu-mir-501
(76 sentences)

Stem-loop
       -   ---  -u       c       uc     u   u     aaaa   uau 
5' cuuc ugc   uc  gcucauc ucucuaa  cuuug ccc gggug    ugc   u
   |||| |||   ||  ||||||| |||||||  ||||| ||| |||||    |||   u
3' gagg acg   ag  cgagugg agggguu  ggaac ggg cccac    acg   g
       u   ucu  uc       a       ua     -   -     -gua   uau 
Get sequence
Deep sequencing
67152 reads, 154 reads per million, 105 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 7241243-7241351 [-]
sense
OTTMUST00000039775 ; Clcn5-003; intron 2
OTTMUST00000039776 ; Clcn5-004; intron 3
OTTMUST00000039777 ; Clcn5-005; intron 3
ENSMUST00000128319 ; Clcn5-003; intron 2
ENSMUST00000115746 ; Clcn5-004; intron 3
ENSMUST00000132126 ; Clcn5-005; intron 3
Clustered miRNAs
< 10kb from mmu-mir-501
mmu-mir-532chrX: 7248402-7248497 [-]
mmu-mir-188chrX: 7247989-7248056 [-]
mmu-mir-362chrX: 7241982-7242046 [-]
mmu-mir-501chrX: 7241243-7241351 [-]
mmu-mir-500chrX: 7237683-7237774 [-]
Database links

Mature sequence mmu-miR-501-5p

Accession MIMAT0003508
Previous IDsmmu-miR-501
Sequence

24 - 

aauccuuugucccugggugaaa

 - 45

Get sequence
Deep sequencing3668 reads, 94 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-501-3p

Accession MIMAT0003509
Previous IDsmmu-miR-501*
Sequence

61 - 

aaugcacccgggcaaggauuug

 - 82

Get sequence
Deep sequencing63462 reads, 105 experiments
Evidence experimental; MPSS [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).